Development of an INDEL typing system for ctx+ strains of Vibrio cholerae from the seventh pandemic

全文:

BACKGROUND

The seventh cholera pandemic involved the formation of clones of Vibrio cholerae with new genetic properties, including those with the ability to spread worldwide and cause diseases with a more severe clinical course [1–3]. The widespread distribution of such genetic variants of V. cholerae and the possibility of their occurrence in Russia require continuous comprehensive monitoring using modern molecular genetic technologies that provide accelerated diagnostics and timely identification with determination of the epidemic significance of the cholera pathogen for making prompt management decisions [4–6].

Molecular genetic monitoring of V. cholerae is based on the analysis of several well-studied genetic markers. The analysis of variable number tandem repeats (VNTR) and INDEL loci have become widespread. In determining VNTR, a complex and labor-intensive method of VNTR typing of toxigenic V. cholerae isolated in various regions worldwide has been proposed and is widely used [7–11]. The high stability of VNTR loci contributes to obtaining valid results [12]. Recently, VNTR typing has been successfully used in combination with whole-genome sequencing [10, 13–15].

The INDEL typing method is simpler and more accessible and includes determining the presence of “insertions–deletions” in various genes [16]. The INDEL and VNTR typing methods has its own advantages; however, the most informative results were obtained by combining the two typing methods [17].

The relatively easy-to-use method of INDEL typing of V. cholerae is suitable for studying non-toxigenic strains [17], but cannot be used for intraspecific typing of toxigenic strains, because all ctx+ cultures with the used set of INDEL loci form only one INDEL genotype [16].

This study aimed to improve INDEL typing of ctx+ strains of V. cholerae of the seventh pandemic by using additional INDEL loci.

MATERIALS AND METHODS

This study used data from whole-genome sequencing of toxigenic (ctxAB+tcpA+) V. cholerae O1 El Tor strains obtained on the Illumina MiSeq platform during the implementation of the strategic initiative of socio-economic development of Russia until 2030 “Sanitary shield of the country is the health safety (prevention, detection, response)” (40 strains), 1531 genomes from the NCBI database, and 534 genomes from the European Nucleotide Archive database, presented in the form of reads, which assembly was performed using the Spades program [18]. Information on the date and place of isolation of the strain was obtained from the attached description [19].

For the analysis, we used our own scripts written in the Java and Python programming languages. Geocoding of the places of strain isolation was performed using the Nominatim API service. The online geographic information system was developed using the programming languages HTML, JavaScript, and PHP. The freely distributed Leaflet library written in JavaScript was used as the core, and maps obtained from the Open StreetMap community were used as cartographic data.

RESULTS

Following bioinformatics analysis, over 40 promising INDEL loci were tested for intraspecific typing of toxigenic strains of V. cholerae. Each INDEL locus in the chromosome was represented by two alleles; hence, the allele size could be determined by the results of electrophoresis after the polymerase chain reaction (PCR) in the presence of an in vitro culture or in silico according to the bioinformatics analysis of the nucleotide sequence from databases. Based on the test results, eight INDEL loci were selected for further study.

 

Table 1. INDEL loci for ctx+ Vibrio cholerae typing

No.	Locus	Primers	Position in the genome*	Allele size of INDEL loci
1	1095	ccatcagtctgcctctgacac ttcgacaatcgtcagtagcg	CP028828: 1053058–1052964	87/95
2	rtxA4	tgcaactgggtataacccaatggg tggtgtaccaagacgttcgccaa	CP028827: 1533766–1533377	330/390
3	VC2566	tggttatggattgctgcaagt agtcagtgcgtccagcattt	CP028827: 333608–333522	87/171
4	VCA0667	gacggatatgttgcagtcagc ctcccgagatactccatgtacc	CP028828: 606894–606795	88/100
5	VC1446	gcctatcaagcttgcatgtg tggccaaatacggtattgcg	CP028827: 1540677–1540770	94/100
6	3186	agttggagtgccgtcaaca gcagggtgatagacggtgat	CP028827: 212759–212693	67/74
7	VCA0730	ggggatgaagtaaatgttccga aacaactctacgcaggcttg	CP028828: 677974–677879	90/96
8	VCA0834	tcgcgataaaaggtttagtgatc aaggatccacttcgcgtcc	CP028828: 781715–781810	89/96

* Position is indicated according to the reference genome of Vibrio cholerae El Tor N16961 (NCBI accession numbers: CP028827 and CP028828).

 

They included the already described loci (i.e., 1095 [20], 3186 [16], and rtxA4 [21]) and those identified in this study (i.e., 2566, 0667, 1446, 730, and 834). Primers were designed for the identified loci (Table 1), which formed amplicons of 67–390 base pairs in size when conducting PCR, which allowed them to be identified during gel electrophoresis. The distribution of alleles of eight INDEL loci among the 2105 studied ctx+ genomes formed 11 unique INDEL clusters, which were designated as A–K (Table 2).

 

Table 2. INDEL genotypes of ctx+ Vibrio cholerae and allele sizes of eight INDEL loci

INDEL genotype	Sizes of amplicons, base pairs
	1095	rtxA4	VC2566	VCA0667	VC1446	3186	VCA0730	VCA0834
A	95	390	87	100	94	67	96	96
B	87	390	87	100	94	67	96	96
C	87	330	87	100	94	67	96	96
D	87	330	87	88	94	67	96	96
E	95	390	171	100	94	74	96	96
F	95	390	171	100	94	67	96	96
G	95	390	87	100	94	67	96	89
H	95	390	87	100	94	67	90	96
I	95	390	171	100	100	74	96	96
J	95	390	87	100	100	67	96	96
K	87	389	87	100	94	67	96	96

 

Based on the number of strains in the clusters, three clusters (A, B, and C) were major, and they accounted for 89% of the studied sequences. Clusters D, E, F, G, and H were intermediate and constituted 10.5% of the studied sequences. Three clusters (I, J, and K) were represented by single strains (Table 3). INDEL clusters ctx+ V. cholerae differed in the time of formation. The strains in the first four clusters were isolated in the twentieth century (A in 1941, F in 1957, G in 1993, and E in 1999), whereas the remaining strains, isolated in the twenty-first century (from 2003 to 2016), were included in seven clusters, among which, B and C were two major ones.

DISCUSSION

In 2019–2023, representatives of four INDEL clusters, namely, A, B, D, and E, have been active, with only isolates from clusters A, B, and D recorded over the past 3 years. For representatives of different clusters, the circulation time (isolation period) of the strains ranged from 4 to 21 years. We believe that clusters F and G can be considered “extinct,” because no strains with such genotypes have been isolated over the past 20 years (Table 3).

 

Table 3. Characteristics of the duration of circulation of ctx+ strains of Vibrio cholerae of various INDEL clusters

No.	INDEL cluster	Number of strains in the INDEL cluster	Years of strain isolation	Time of active circulation, years
1	A	1284	1941–2023	Active since 1941
2	B	415	2004–2022	19
3	C	161	2012–2018	7
4	D	101	2016–2023	Active since 2016
5	E	55	1999–2021	22
6	F	36	1957–1997	41
7	G	27	1993–2000	8
8	H	15	2003–2017	15
9	I	2	2006–2010	5
10	J	2	2015–2017	3
11	K	7	2011–2014	4

 

Representatives of major INDEL clusters A, B, and C have caused several serious outbreaks on various continents, indicating that the strains that form these clusters have a high epidemic potential. Thus, epidemic complications in Haiti and propagations to Africa in 2009–2012 were caused by representatives of cluster B, and the outbreak in Yemen was caused by strains of cluster C (Table 4). In 2023, three toxigenic strains were isolated in Russia: one representative of cluster A (Rostov-on-Don) and two representatives of cluster D (Tambov, Moscow).

A study of the circulation periods of ctx+ V. cholerae, which are part of INDEL clusters (Tables 3 and 4), showed that representatives of different clusters have different epidemic potential. Thus, strains of cluster F that circulated in Indonesia and Australia until 1997 were isolated in the USA as a result of studying three single introductions. This may indicate the “extinction” of this branch, owing to the low epidemic potential of the ctx+ strains included in it. The low number of pathogen removals from circulation foci indicates a low epidemic potential of strains in the intermediate and minor INDEL clusters E–K. According to this criterion, strains of INDEL clusters A, B, and D are characterized by an increased epidemic potential and may displace previously formed strains [2, 22].

It is interesting to evaluate in silico the efficiency of the proposed INDEL typing scheme for ctx+ V. cholerae with a similar system based on the use of SNP analysis of whole-genome sequences.

 

Table 4. Characteristics of the geographical distribution of ctx+ strains of Vibrio cholerae of various INDEL clusters

No.	INDEL cluster	Characteristics of the main focus	Infection introduction from the main focus
1	A	India, 1941	Pandemic spread on all continents. Introduction in Russia (34 pcs): 1970–1973, 1993–1994, 1999, 2001, 2005, 2011, 2014, 2023
2	B	India, 2004	Haiti, 2010–2022; Africa, 2009–2012. The last isolation of 26 strains was in England, 2019. Introduction in Russia: 2010, 2011
3	C	India, 2012	Africa, 2015–2018; Yemen, 2016, 2017
4	D	India, 2016; Bangladesh, 2018 91 isolates of 101 strains were isolated in India and Bangladesh	Iraq, 2017; USA, 2019, 2021–2022; Australia, 2022; Pakistan, 2022; South Africa, 2023 Introduction in Russia: 2023 (Tambov, Moscow)
5	E	Taiwan, 2007 45 out of 55 strains were isolated in Taiwan	South Africa, 2018–2020; China, 2021
6	F	Indonesia, 1957; Australia, 1977–1997 30 of 36 strains were isolated in Australia	USA, 1974, 1978, 1986
7	G	China, 1993	Introduction in Russia: 1999
8	H	Nepal, 2003	Taiwan, 2004–2017; Iraq, 2017; South Korea, 2016
9	I	China, 2006	No introduction
10	J	Congo, 2015	Haiti, 2017
11	K	Nigeria, Togo, 2011	Ghana, 2014

 

Analysis of 1757 SNPs revealed three waves and at least eight different phylogenetic lineages of V. cholerae, with isolates of the classical biotype forming a separate, highly clustered group, distant from the isolates from El Tor of the seventh pandemic [22, 23]. In the present study, the strains of the major INDEL cluster A may correspond to the strains of wave 1, which are characterized by the absence of the integrative conjugative element ICE, which distinguishes them from the strains of wave 2 [22]. However, INDEL cluster A includes ICE-positive and ICE-negative isolates. In the future, if necessary, additional INDEL markers to differentiate subgroups within the pandemic INDEL cluster A is recommended.

Subsequently, another study used the same SNP typing technique to analyze 1070 V. cholerae O1 strains isolated in 45 African countries over a 49-year period using 9300 single-nucleotide substitutions [24]. The typing scheme was expanded when analyzing 1203 genomes using 9986 SNPs [25]. A subsequent study [26] used 10,679 SNPs, which resulted in the identification of 15 sublineages (AFR1–AFR15). The number of SNPs used was increased to probably increase the method reliability, as cases of significant discrepancies in the results of SNP typing have been described using different sets of SNPs [27].

To compare two different molecular typing methods, a comparative study of cholera outbreaks on the African continent was conducted using the INDEL typing method developed in the current study and SNP typing technique [24, 25] (Table 5).

 

Table 5. Comparative study of ctx+ strains of Vibrio cholerae isolated in the African continent by INDEL typing and SNP analysis

Number of strains	Years of strain isolation	INDEL cluster	SNP sublines according to the scheme [24, 25]
322	1981–2017	A	Т1-Т12
23	2009–2012	B	Т12
18	2014–2018	C	T13
7	2018–2020	E	No
1	2015	J	Т7
7	2011–2014	K	Т12

 

SNP typing showed that epidemic complications were associated with strains of one extended lineage, which was brought at least 11 times since 1970. Overall, 12 sublineages of V. cholerae (T1–T12) were identified using SNP typing; subsequently, sublineage 13 was discovered, which caused a cholera outbreak in Yemen [24, 25].

INDEL typing results showed that the introductions into the countries of the African continent were caused by strains included in eight clusters A, B, C, E, J, and K out of 11 clusters described and not a single SNP lineage. Representatives of INDEL clusters D, F, G, and H in Africa were not detected. The major INDEL cluster A included representatives of all 12 sublineages identified by SNP analysis (T1–T12). The minor INDEL cluster J corresponded to sublineage T7. Sublineage T12 strains were part of INDEL clusters A, B, and K (Table 5). Interestingly, the scheme of Weill in 2017 did not include strains of INDEL cluster E, which caused repeated introductions in South Africa in 2018, 2019, and 2020 (Table 4).

Analysis of strains isolated on the African continent indicated that the proposed method of INDEL typing of ctx+ strains of V. cholerae is not inferior in resolution to the SNP typing technique [24, 25]. The advantage of the proposed method is the simplicity and clarity of the presentation of the results.

Based on the distribution of eight INDEL loci identified, the geoinformation system “INDEL genotypes of V. cholerae O1 strains” was created, located on the geoinformation portal of the Rostov-on-Don Anti-Plague Institute of Rospotrebnadzor (http://gis.antiplague.ru/s_Vcholerae_INDEL.php). The integrated convenient system of filters and search allows for prompt molecular monitoring of ctx+ strains from available databases for various requests, displaying the locations of isolation and number of isolated cultures on the map (Fig. 1).

 

Fig. 1. Appearance of the geographic information system “INDEL genotypes of V. cholerae O1 strains”. The result of a query on the geographical distribution of strains of the major INDEL cluster A is presented. The circles show the places where the strains were isolated, the number in the circle corresponds to the number of isolated strains. The color of the marker and its shape reflect the number of isolated cultures: single strains — with an star; from 2 to 10 — green circle; from 10 to 100 — yellow circle, over 100 — orange circle.

 

SNP typing is extremely labor-intensive and requires high-quality sequencing and significant computer time to process whole-genome sequencing data. Its result depends on the number of SNPs used. The proposed INDEL typing method at eight loci can be quickly performed using routine PCR, if necessary, without resorting to labor-intensive and expensive sequencing. The advantage of the proposed method of INDEL typing of ctx+ V. cholerae is the ability to conduct research in vitro in the presence of a pathogen culture and in silico when analyzing the whole-genome nucleotide sequence for the purpose of molecular monitoring of cholera.

CONCLUSION

The obtained INDEL typing data enable to consider the ctx+ V. cholerae population as a complex biological system characterized by several genetically different INDEL clusters. Moreover, the formation and extinction of individual clusters have been noted [22]. Clusters A and D, which caused the introduction of viruses in Russia in 2023, can be considered active at present. In the future, it is recommended to search for additional loci that potentially allow intracluster typing of major INDEL clusters. Promising targets for analysis may be ICE elements or genes that provide resistance to the toxic effects of heavy metals. Additionally, we believe that studies aimed at identifying new factors and determinants of pathogenicity should focus on representatives of these genetic groups. In this case, representatives of inactive INDEL clusters can be considered as a negative control in a comparative study of genomes.

Additional information

Funding source. This work was not supported by any external sources of funding.

Competing interests. The authors declare that they have no competing interests.

Authors’ contribution. All authors made a substantial contribution to the conception of the work, acquisition, analysis, interpretation of data for the work, drafting and revising the work, final approval of the version to be published and agree to be accountable for all aspects of the work. S.O. Vodopyanov — conducting bioinformation analysis of a collection of strains, writing and editing the text of the article; A.S. Vodopyanov — identification of INDEL markers, writing the text of the article.

作者简介

Sergey Vodopyanov

Rostov-on-Don Plague Control Researsh Institute

编辑信件的主要联系方式.
Email: serge100v@gmail.com
ORCID iD: 0000-0003-4336-0439
SPIN 代码: 4672-9310
Scopus 作者 ID: 6701686549

MD, Dr. Sci. (Medicine)

俄罗斯联邦, 117/40 M. Gor’kogo street, 344002 Rostov-on-Don

Alexey Vodopyanov

Rostov-on-Don Plague Control Researsh Institute

Email: vodopyanov_as@antiplague.ru
ORCID iD: 0000-0002-9056-3231
SPIN 代码: 7319-3037

MD, Cand. Sci. (Medicine)

俄罗斯联邦, 117/40 M. Gor’kogo street, 344002 Rostov-on-Don

参考

补充文件