DEVELOPMENT AND STUDY OF THE PERFORMANCE OF THE REAGENT KIT FOR THE IDENTIFICATION OF VIBRIO CHOLERAE AND VIBRIO PARAHAEMOLYTICUS BY MULTILOCUS ALLELE-SPECIFIC PCR IN CLINICAL TRIALS

Full Text

Open Access Open Access
Restricted Access Access granted
Restricted Access Subscription or Fee Access

Abstract

The aim of the study was to develop, conduct clinical trials and evaluate the performance of the "Reagent kit for identification of V. cholerae and V. parahaemolyticus by multilocus allele-specific PCR" ("Vibrio-screen FL") for the state registration of the specified medical device.

Materials and methods. The results of clinical trials of the reagent kit "Vibrio-screen FL" that has been developed to optimize the means and methods of identification and differentiation of pathogens of particularly dangerous infections are presented in the article. Clinical trials were conducted at the Head Center of Hygiene and Epidemiology of the FMBA of Russia (license from 02.12.2013 No. ФС-99-01- 008342; permission of the Ministry of Health from 16.05.2013 No. 300n) in accordance with the program of clinical trials No. 20.ПМКИ-042/10.20 from 23.09.2020 (Clinical Trial Certificate No. 01.AK-042/10.20 dated 12.10.2020). To conduct clinical trials clinical strains of microorganisms Vibrio spp. and other microorganism species were used as target analytes. Research methods included bacteriological method and multilocus PCR .

Results. The reagent kit "Vibrio-screen FL" is a medical device for professional use in clinical laboratory diagnostics. The analytical sensitivity of the reagent kit "Vibrio-screen FL" was at least 106 copies of the SecY gene when determining belonging to the genus Vibrio; to the species V. cholerae — at least 106 copies of the hlyA gene; and to the species V. parahaemolyticus — at least 106 copies of the vppC gene. When determining the analytical specificity, there were no non-specific reactions with DNA samples of other microorganism species. A medical device for in vitro diagnostics the reagent kit «Vibrio-screen FL» meets the requirements of the intended use, which allows it to be used for the differentiation of V. cholerae and V. parahaemolyticus strains isolated from a cultured clinical samples by the method of multilocus allele-specific polymerase chain reaction with hybridization-fluorescent detection. The registration certificate № РЗН 2021/13360 from 08.02.2021 was received. By order of Roszdravnadzordated 08.02.2021 No. 1041, a reagent kit Vibrio-screen FL by the Rostov-on-Don Plague Control Researsh Institute was admitted to distribution on the territory of the Russian Federation.

Conclusions. The reagent kit "Vibrio-screen FL" is a high-quality, effective and safe  medical device for in vitro diagnostics with sufficient diagnostic sensitivity and specificity to identify specific fragments of Vibrio spp., V. cholerae and V. parahaemolyticus nucleic acids, which allows it to be used in clinical laboratory diagnostics, for epidemiological analysis.

Full Text

Токсигенные штаммы Vibrio cholerae являются возбудителем холеры – острой инфекционной болезни из группы карантинных инфекций с диарейным синдромом, фекально-оральным механизмом передачи возбудителя инфекции, водным, пищевым и контактным путями распространения [1–5]. Холера относится к группе инфекций, борьба с которыми регламентируется Международными медико-санитарными правилами (2005)1. Нетоксигенные штаммы V. cholerae вызывают спорадические или групповые (при общем источнике инфицирования) заболевания с клиническими проявлениями гастроэнтерита, не склонные к эпидемическому распространению2. К роду Vibrio также относятся нехолерные патогенные для человека вибрионы, из которых парагемолитические вибрионы являются ведущей причиной гастроэнтеритов и пищевых токсикоинфекций вследствие употребления морепродуктов во всем мире [6–10]. Кроме этого парагемолитические вибрионы могут быть причиной заболеваний не только пищевого характера. Известны случаи инфицирования ран [11, 12], ушей [13], септицемии, вызванных V. parahaemolyticus и связанные с пребыванием в морской воде [11, 14, 15]. В России парагемолитические вибрионы распространены на побережьях Черного, Азовского морей, на территории Приморского края.

Выявление и дифференциация возбудителей холеры и острых кишечных инфекций, вызываемых патогенными для человека вибрионами, актуальны при проведении клинической лабораторной диагностики и эпидемиологического мониторинга [16, 17].

На сегодняшний день разработано большое число тест-систем для ПЦР-детекции штаммов V. cholerae, которые позволяют определять не только видовую принадлежность, но и токсигенность, серогруппу, биовар, эпидемическую значимость. Зарегистрированные ПЦР тест-системы для выявления ДНК V. parahaemolyticus в клиническом материале в России отсутствуют. В Ростовском-на-Дону противочумном институте разработан способ идентификации штаммов вида V. parahaemolyticus (ген металлопротеазы (коллагеназы) – vppC) на основе метода полимеразной цепной реакции (ПЦР) с детекцией продуктов амплификации в режиме реального времени (Патент № RU 2644232 от 08.02.2018 г.)  [18, 19].

Однако создание отдельных реагентов для выявления каждого из видов в отдельности сопряжено с большими трудозатратами, поэтому актуальным представляется выбор мишени, позволяющей проводить идентификацию микроорганизмов рода Vibrio.

В связи с этим необходима разработка, внедрение в практику здравоохранения тест-систем для ПЦР-детекции штаммов рода Vibrio, что будет способствовать оптимизации эпидемиологического надзора за холерой за счёт значительного снижения времени и трудоемкости исследования, а также позволит выявлять патогенные для человека парагемолитические вибрионы.

Цель работы – разработка, проведение клинических испытаний и оценка эффективности «Набора реагентов для идентификации V. cholerae и V. parahaemolyticus методом мультилокусной аллель-специфической ПЦР» (далее Набор реагентов «Vibrio-скрин FL») в рамках процедуры государственной регистрации указанного медицинского изделия.

Материалы и методы

Клинические испытания набора реагентов «Vibrio-скрин FL» были проведены на базе аккредитованного испытательного лабораторного центра Головного центра гигиены и эпидемиологии ФМБА России.

Для проведения клинических испытаний разработанного набора реагентов «Vibrio-скрин FL» в качестве целевых аналитов были использованы: штаммы микроорганизмов рода Vibrio V. cholerae  из клинического материала (15 штаммов) и объектов окружающей среды (ООС) (5 штаммов); штаммы V. parahaemolyticus из клинического материала (15 штаммов) и ООС (5 штаммов); V. alginolyticus (10 штаммов); V. fluvialis (4 штамма); V. vulnificus (4 штамма), гетерологичные микроорганизмы (Salmonella typhi, Shigella dysenteriae, Escherichia coli, Yersinia enterocolitica, Proteus vulgaris, Aeromonas spp., Pseudomonas aeruginosa, Helicobacter pylori, Streptococcus faecium, Staphylococcus aureus, Entorococcus faecium, Candida albicans – по 1 штамму) из лаборатории «Коллекция патогенных микроорганизмов» Ростовского-на-Дону противочумного института.

Для получения чистой культуры V. cholerae использовали питательную среду для выделения и культивирования холерного вибриона сухую «Щелочной агар». Для культивирования V. parahaemolyticus применяли питательную среду для выделения и культивирования холерного вибриона сухую «Щелочной агар» с добавлением 2 % NaCl. Штаммы культивировали согласно МУК 4.2.2218-073 «Лабораторная диагностика холеры». Для культивирования прочих микроорганизмов использовали «Питательный агар для культивирования микроорганизмов (агар Хоттингера в модификациях)».

В работе использованы данные полногеномного секвенирования штаммов рода Vibrio (V. anguillarum, V. cholerae, V. fischeri, V. harveyi, V. nigripulchritudo, V. parahaemolyticus, V. vulnificus) и ряда близкородственных микроорганизмов (Bacillus cereus, Escherichia coli, Photobacterium spp., Salinivibrio spp.), полученные из системы GenBank. Для анализа использовали авторское программное обеспечение «GeneExpert», разработанное на языке программирования Java [20]. Проверку разработанных праймеров проводили с помощью авторской программы «Virtual PCR» [21] с использованием локальной базы данных геномов. Для дизайна праймеров использовали авторскую программу «PrimerM».

Тип анализируемого образца для проведения ПЦР препараты ДНК, выделенные из культур микроорганизмов, выросших на твердых питательных средах. Для их получения бактериальную массу смывали стерильным физиологическим раствором. Из полученных микробных взвесей готовили ряд серийных разведений в физиологическом растворе. Концентрацию бактериальных клеток определяли по отраслевому стандартному образцу мутности Государственного НИИ стандартизации и контроля медицинских биологических препаратов им. Л.А. Тарасевича (ОСО 42-28-59-86П). В соответствии с количеством бактериальных клеток определяли количество копий генов, учитывая, что используемые гены однокопийны.

Выделение ДНК из проб, обеззараженных в соответствии с МУ 1.3.2569-094, проводили с помощью зарегистрированного в установленном порядке набора реагентов для выделения ДНК/РНК из биологического материала «РИБО-преп» (ЦНИИ Эпидемиологии).

Для изучения диагностических характеристик испытуемого набора реагентов «Vibrio-скрин FL» были использованы:

- набор сравнения 1 – набор реагентов для выявления ДНК Vibrio cholerae и идентификации патогенных штаммов Vibrio cholerae в биологическом материале и объектах окружающей среды методом ПЦР с гибридизационно-флюресцентной детекцией «АмплиСенс Vibrio cholerаe-FL» (ЦНИИ Эпидемиологии);

- набор сравнения 2 – набор реагентов для приготовления питательной среды для выделения и первичной идентификации парагемолитических вибрионов (Набор ПГСВ; Ростовский-на-Дону противочумный институт).

При изучении диагностической чувствительности испытуемого набора, истинно положительными образцами являлись образцы заявленного материала с выявленной ДНК набором сравнения «АмплиСенс Vibrio cholerаe-FL».

Диагностическая чувствительность была рассчитана в соответствии с формулой:

N= А/(А+B)*100% , где                                                (1)

Nобщее число исследуемых проб с истинно положительными результатами анализа, подтвержденные набором сравнения;

Вчисло исследуемых проб, для которых испытуемым набором был получен отрицательный результат, из общего числа N;

Ачисло исследуемых проб, для которых испытуемым набором был получен положительный результат, из общего числа N.

При изучении диагностической специфичности испытуемого набора истинно отрицательными образцами (пробами) являлись образцы с отрицательным результатом тестирования с помощью наборов сравнения.

Диагностическая специфичность была рассчитана в соответствии с формулой:

S= C/(C+D)*100% , где                                                     (2)

Sобщее число исследуемых проб с истинно отрицательными результатами анализа, подтвержденные набором сравнения;

Cчисло исследуемых проб, для которых испытуемым набором был получен отрицательный результат, из общего числа S;

 Dчисло исследуемых проб, для которых испытуемым набором был получен положительный результат, из общего числа S.

Результаты и обсуждение

Первый этап работы состоял в сравнительном анализе геномов вибрионов разных видов по каждому гену в отдельности с помощью программы «GeneExpert». Это позволило получить перечень генов, обладающих высоким уровнем сходства у представителей разных видов (позитивная селекция). Второй этап работы заключался в исключении генов, обладающим высоким уровнем сходства с представителями «не-вибрионов» (негативная селекция). По итогам этих этапов работы было выбрано несколько генов, являющихся потенциальными кандидатами на роль мишени для разработки праймеров. Наибольший интерес представлял ген SecY, кодирующий «preprotein translocase subunit SecY» [22, 23]. Именно этот ген обладал наибольшим сходством у вибрионов при этом существенно отличался от аналогичного гена у других микроорганизмов.

С помощью авторской программы «PrimerM» нами были сконструированы праймеры для выявления данного гена в ПЦР:

прямой – GACAAGATTTTCGTAGTGCTCAGA;

обратный – ACGATGGTACCTTTTTGCTGTTC.

Для проверки in silico была использована база геномов, созданная на предыдущем этапе. В сравнительный анализ были добавлены праймеры, предложенные другими авторами на другие гены. Согласно данным виртуальной ПЦР in silico, именно предлагаемые праймеры на ген SecY позволяют проводить успешное выявление микроорганизмов рода Vibrio, не образуя ампликона со штаммами других родов (табл. 1).

Таблица 1 / Table 1

Результаты ПЦР in silico

PCR results in silico

Штамм

Strain

Размер ампликона с праймерами к гену

The size of the amplicon with primers to the gene

16S

16S-23S

ompW

VC1650

VCA0164

hlyA-1

hlyA-2

SecY

Photobacterium

888

-

-

-

-

-

-

-

Salinivibrio

888

-

-

-

-

-

-

-

V. anguillarum

889

-

-

-

-

-

-

166

V. cholerae O1 18470

889

-

588

361

675

738

481

166

V. cholerae nonO1/nonO139 HE-16

889

-

588

349

-

738

481

166

V. cholerae O1 MJ-1236

889

296

588

397

675

738

481

166

V. cholerae O139 MO10

889

-

588

406

675

738

481

166

V. harveyi

888

-

-

-

-

-

-

166

V.nigripulchritudo

888

317

-

-

-

-

-

166

V. parahaemolyticus

889

-

-

-

-

-

-

166

V. vulnificus

889

-

-

-

-

-

-

166

E. coli

888

-

-

-

-

-

-

-

Bacillus cereus

888

-

-

-

-

-

-

-

 

Для создания набора реагентов «Vibrio-скрин FL» в рамках федеральной целевой программы «Национальная система химической и биологической безопасности Российской Федерации (2015-2020 годы)» были использованы родоспецифический ген SecY для микроорганизмов рода Vibrio, для дифференциации V. cholerae предложен ген hlyA, для V. parahaemolyticus – ген vppC.

 В состав разработанного набора реагентов «Vibrio-скрин FL» входят:

1) раствор «Taq ДНК-полимераза» готов к использованию и представляет собой Taq ДНК-полимеразу 5 ед.акт./мкл («Евроген», Россия);

2) реакционная смесь «Вибрио-род» после добавления Taq ДНК-полимеразы готова к использованию и содержит мультиплексную смесь праймеров и зонда: праймер SecY_up (CAGCATAAAGGTACCATCGTAGAAAT) в количестве 1 нмоль («Синтол», Россия); праймер SecY_down (GATAACAATTGACGCCGAAATATAC) в количестве 1 нмоль («Синтол», Россия); флуоресцентный зонд SecY_HEX [R6G]-ACGCTGCTGTACTTGCCGAATTGT-[BHQ1] в количестве 0,3 нмоль («Синтол», Россия); детекция осуществляется по каналу HEX (SecY);

3) реакционная смесь «Вибрио-вид» после добавления Taq ДНК-полимеразы готова к использованию и содержит мультиплексную смесь праймеров и зондов: праймер hlyA_up (ATGCCTATTTCCGTGAGTGG) в количестве 1 нмоль («Синтол», Россия); праймер hlyA_down (CCCCAAGTTCAAAACCTGAA) в количестве 1 нмоль («Синтол», Россия); праймер vppC_up (CGGCAAGCGTGGTTTGTGAC) в количестве 1 нмоль («Синтол», Россия); праймер vppC_down (CGTTGATGCAACTTGCACCTTG) в количестве 1 нмоль («Синтол», Россия); флуоресцентный зонд hlyA_HEX [R6G]-TCAACCGATGCGATTGCCCAAGA-[BHQ1] в количестве 0,3 нмоль («Синтол», Россия); флуоресцентный зонд vppC_ROX ((ROX)-CGTTCACAACCACCAACAGCAACGACTTG-(BHQ2)) в количестве 0,3 нмоль («Синтол», Россия); детекция осуществляется по каналам HEX (hlyA) и ROX (vppC);

4) положительный контрольный образец готов к использованию и представляет собой смесь препаратов ДНК V. cholerae 19923 и V. parahaemolyticus 14806 в концентрации 2*107 копий генов/мл;

5) отрицательный контрольный образец готов к использованию и представляет собой деионизованную стерильную воду, свободную от ДНКаз. Набор для выделения ДНК приобретается отдельно, в комплект поставки не входит.

Сконструированный набор реагентов «Vibrio-скрин FL» относится к изделиям медицинского назначения для профессионального применения в клинической лабораторной диагностике и при проведении эпидемиологического мониторинга для выявления специфических участков нуклеиновых кислот V. cholerae и V. parahaemolyticus, выделенных из клинических образцов, в бактериологических лабораториях.

Принцип действия набора реагентов «Vibrio-скрин FL» заключается в проведении мультилокусной ПЦР с гибридизационно-флуоресцентной детекцией результатов.

В ходе клинико-лабораторных испытаний разработанного набора реагентов «Vibrio-скрин FL» была проведена идентификация испытуемого набора, включающая: оценку внешнего вида, комплектности, упаковки и маркировки, соответствия этих показателей качества, указанным в эксплуатационной документации; анализ представленной документации с проведением экспериментальной апробации инструкции по применению испытуемого набора; определение диагностических характеристик (чувствительности и специфичности); анализ клинической безопасности испытуемого набора реагентов согласно экспериментальной апробации инструкции по применению испытуемого набора.

Внешний вид, комплектность, упаковка и маркировка набора реагентов «Vibrio-скрин FL» соответствует всем характеристикам, заявленным в его эксплуатационной и технической документации.

В ходе клинико-лабораторных испытаний было установлено, что функциональные показатели набора реагентов «Vibrio-скрин FL» соответствуют показателям, заявленным в эксплуатационной и технической документации на данное медицинское изделие в отношении всех использованных штаммов микроорганизмов – целевых аналитов: V. cholerae и V. parahaemolyticus. Результаты идентификации холерного вибриона и его дифференциации от V. parahaemolyticus с использованием набора реагентов «Vibrio-скрин FL» и с помощью изделий сравнения имеют полное соответствие (100%).

Показанием к применению набора реагентов «Vibrio-скрин FL» является выявление специфической ДНК в выделенных культурах для подтверждения принадлежности к роду Vibrio, дифференциации видов Vibio spp., V. сhоlеrае и V. parahaemolyticus при подозрении на инфицирование бактериями рода Vibrio в ходе проведения клинической лабораторной диагностики и эпидемиологического мониторинга.

Для оценки диагностических характеристик (диагностической чувствительности и диагностической специфичности) испытания проводились посредством параллельного проспективного исследования одних и тех же образцов испытуемым набором реагентов и набором сравнения. Изучение диагностической чувствительности было проведено на препаратах, содержащих ДНК 20 штаммов V. cholerae и 20 штаммов V. parahaemolyticus. Диагностическая чувствительность составила 100,0% (95% ДИ 91,19%-100,00%). Изучение диагностической специфичности было проведено на препаратах, содержащих ДНК 30 штаммов – клинических изолятов, выделенных в ходе микробиологической диагностики холеры как сопутствующая флора, а также ДНК штаммов из лаборатории «Коллекция патогенных микроорганизмов» Ростовского-на-Дону противочумного института.  Диагностическая специфичность составила 100,0% (95% ДИ 88,43-100,00%).

Аналитическая чувствительность набора реагентов «Vibrio-скрин FL» составила при определении принадлежности к роду Vibrio – не менее 106 копий гена/мл SecY; при определении принадлежности к виду V. cholerae – не менее 106 копий гена/мл hlyA; при определении принадлежности к виду V. parahaemolyticus – не менее 106 копий гена/мл vppC.  

При определении аналитической специфичности отсутствовали неспецифические реакции при тестировании панели образцов ДНК штаммов Salmonella typhi, Shigella dysenteriae, Escherichia coli, Yersinia enterocolitica, Proteus vulgaris, Aeromonas spp., Pseudomonas aeruginosa, Helicobacter pylori, Streptococcus faecium, Staphylococcus aureus, Entorococcus faecium, Candida albicans.

Таким образом, в ходе испытаний образцы испытуемого набора реагентов показали надёжность и удобство обращения в условиях практической лаборатории. В ходе испытаний факты и обстоятельства, создающие условия неэффективности и (или) прямой или косвенной угрозы жизни и здоровью медицинских работников при применении и эксплуатации набора реагентов «Vibrio-скрин FL» не установлены.

Разработанный «Набор реагентов для идентификации V. cholerae и V. parahaemolyticus методом мультилокусной аллель-специфической ПЦР (Vibrio-скрин FL)» успешно прошел процедуру государственной регистрации в качестве изделия медицинского назначения. Получено регистрационное удостоверение от 08.02.2021 № РЗН 2021/13360. Приказом Росздравнадзора от 08.02.2021 № 1041 Набор реагентов «Vibrio-скрин FL» допущен к обращению на территории Российской Федерации.

Выводы

  1. Найден специфичный для всех микроорганизмов рода Vibrio и обладающий достаточной консервативностью для конструирования праймеров ген SecY, кодирующий «preprotein translocase subunit SecY». Созданы праймеры на ген SecY, позволяющие проводить успешное выявление микроорганизмов рода Vibrio, не образующие ампликонов со штаммами других родов
  2. Сконструирован набор реагентов «Vibrio-скрин FL», который относится к изделиям медицинского назначения для профессионального применения в клинической лабораторной диагностике и при проведении эпидемиологического мониторинга для выявления специфических участков нуклеиновых кислот Vibrio spp., cholerae и V. parahaemolyticus, выделенных из клинических образцов, в бактериологических лабораториях, имеющих разрешение на работу с микроорганизмами III-IV групп патогенности, на проведение диагностических исследований на холеру.
  3. Медицинское изделие для диагностики in vitro «Набор реагентов для идентификации cholerae и V. parahaemolyticus методом мультилокусной аллель-специфической ПЦР (Vibrio-скрин FL)» является качественным, эффективным и безопасным диагностическим медицинским изделием для диагностики in vitro с достаточными диагностическими чувствительностью и специфичностью, соответствует предназначенному применению и предлагаемым методам использования, что позволяет использовать его в клинической лабораторной диагностике для дифференциации V. cholerae и V. parahaemolyticus, выделенных из клинического образца путем культивирования, методом мультилокусной аллель-специфической ПЦР с гибридизационно-флуоресцентной детекцией и решения эпидемиологических задач по выявлению случаев заболеваний, вызванных патогенными для человека вибрионами.

 

1 Международные медико-санитарные правила (2005) – 2-е издание, ВОЗ https://www.who.int/ihr/IHR_2005_ru.pdf

2 Санитарно-эпидемиологические требования по профилактике инфекционных болезней СанПин 3.3686-21 - М.: Федеральный центр гигиены и эпидемиологии Роспотребнадзора; 2021 http://nps3.cntd.ru/kodeks02/

3 Лабораторная диагностика холеры. Методические указания.  МУК 4.2.2218-07. - М.: Федеральный центр гигиены и эпидемиологии Роспотребнадзора; 2007.87 с.

4 Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I—IV групп патогенности: Методические указания. МУ 1.3.2569-09. - М.: Федеральный центр гигиены и эпидемиологии Роспотребнадзора; 2010. 51 с.

×

About the authors

Olga S. Chemisova

Rostov-on-Don Plague Control Researsh Institute

Author for correspondence.
Email: chemisova@inbox.ru
ORCID iD: 0000-0002-4059-2878
SPIN-code: 1129-7436
Scopus Author ID: 6505888018

Cand. Sci. (Biol.), Head of the laboratory "Collection of pathogenic microorganisms"

Russian Federation, 117/40, Gorky Street, Rostov-on-Don, 344002

Marina V. Poleeva

Rostov-on-Don Plague Control Researsh Institute

Email: poleeva_mv@antiplague.ru
ORCID iD: 0000-0001-8086-376X

Head of the Department of scientific and educational support

Russian Federation, 117/40, Gorky Street, Rostov-on-Don, 344002

Sergey O. Vodopyanov

Rostov-on-Don Plague Control Researsh Institute

Email: serge100v@gmail.com
ORCID iD: 0000-0003-4336-0439
SPIN-code: 4672-9310

D. Sci. (Med.), main researcher, Department of Microbiology of cholera and other acute intestinal infections

Russian Federation, 117/40, Gorky Street, Rostov-on-Don, 344002

Alexey S. Vodopyanov

Rostov-on-Don Plague Control Researsh Institute

Email: alexvod@gmail.com
ORCID iD: 0000-0002-9056-3231

Cand. Sci. (Med.), leading researcher, Laboratory of molecular biology of natural focal and zoonotic infections

Russian Federation, 117/40, Gorky Street, Rostov-on-Don, 344002

Alexey L. Trukhachev

Rostov-on-Don Plague Control Researsh Institute

Email: trukhachev_al@antiplague.ru
ORCID iD: 0000-0002-3531-1146

Cand. Sci. (Med.), leading researcher, Laboratory of molecular biology of natural focal and zoonotic infections

Russian Federation, 117/40, Gorky Street, Rostov-on-Don, 344002

Ruslan V. Pisanov

Rostov-on-Don Plague Control Researsh Institute

Email: pisanov_rv@antiplague.ru
ORCID iD: 0000-0002-7178-8021

Cand. Sci. (Biol.), Head of the laboratory of molecular biology of natural focal and zoonotic infections

Russian Federation, 117/40, Gorkogo street, Rostov-on-Don, 344002

Vladimir D. Kruglikov

Rostov-on-Don Plague Control Researsh Institute

Email: kruglikov_vd@antiplague.ru
ORCID iD: 0000-0002-6540-2778

D. Sci. (Med.), Head of the department of Microbiology of cholera and other acute intestinal infections

Russian Federation, 117/40, Gorky Street, Rostov-on-Don, 344002

Alexey K. Noskov

Rostov-on-Don Plague Control Researsh Institute

Email: noskov-epid@mail.ru
ORCID iD: 0000-0003-0550-2221

Cand. Sci. (Med.), director

Russian Federation, 117/40, Gorky Street, Rostov-on-Don, 344002

References

  1. Azman A.S., Lauer S.A., Bhuiyan T.R., Luquero F.J., Leung D.T., Hegde S.T., Harris J.B., Kumar K.P., Khaton F., Ferdous J., Lessler J., Salje H., Qadri F., Gurley E.S. Vibrio cholerae O1 transmission in Bangladesh: insights from a nationally representative serosurvey. Lancet Microbe. 2020; 1(8): e336-e343. doi: 10.1016/S2666-5247(20)30141-5.
  2. Deen J., Mengel M.A., Clemens J.D. Epidemiology of cholera. Vaccine. 2020; 38 Suppl 1: A31-A40. doi: 10.1016/j.vaccine.2019.07.078.
  3. Ramamurthy T., Das B., Chakraborty S., Mukhopadhyay A.K., Sack D.A. Diagnostic techniques for rapid detection of Vibrio cholerae O1/O139. Vaccine. 2020; 38 Suppl 1: A73-A82. doi: 10.1016/j.vaccine.2019.07.099.
  4. Nayak S.R., Nayak A.K., Biswal B.L., Pati S., Pal B.B. Spread of Haitian variant Vibrio cholerae O1 causing cholera outbreaks in Odisha, India. Jpn J Infect Dis. 2020. doi: 10.7883/yoken.JJID.2020.364.
  5. Yoon S.H., Waters C.M. Vibrio cholerae. Trends Microbiol. 2019; 27(9): 806-807. doi: 10.1016/j.tim.2019.03.005.
  6. Yeung P.S., Boor K.J. Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathog Dis. 2004; 1(2): 74-88 doi: 10.1089/153531404323143594.
  7. Nair G.B., Hormazábal J.C. The Vibrio parahaemolyticus. Rev Chilena Infectol. 2005; 22(2): 125-30. doi: 10.4067/s0716-10182005000200002.
  8. Osei-Adjei G., Huang X., Zhang Y. The extracellular proteases produced by Vibrio parahaemolyticus. World J Microbiol Biotechnol. 2018; 34(5): 68. doi: 10.1007/s11274-018-2453-4.
  9. Su C., Chen L. Virulence, resistance, and genetic diversity of Vibrio parahaemolyticus recovered from commonly consumed aquatic products in Shanghai, China. Mar Pollut Bull. 2020; 160: 111554. doi: 10.1016/j.marpolbul.2020.111554.
  10. Deepanjali A., Kumar H.S., Karunasagar I., Karunasagar I. Seasonal variation in abundance of total and pathogenic Vibrio parahaemolyticus bacteria in oysters along the southwest coast of India. Appl. Environ. Microbiol. 2005; 71(7): 3575–3580. doi: 10.1128/AEM. 71. 7.3575-3580.2005.
  11. Elmahdi S., DaSilva L.V., Parveen S. Antibiotic resistance of Vibrio parahaemolyticus and Vibrio vulnificus in various countries: A review. Food Microbiol. 2016; 57: 128-34.
  12. Hou C.C., Lai C., Liu W.L., Chao C.M., Chiu Y.H., Hsueh P.R. Clinical manifestation and prognostic factors of non-cholerae Vibrio infections. Eur J Clin Microbiol Infect Dis. 2011; 30(6): 819-24. doi: 10.1007/s10096-011-1162-9.
  13. Baker-Austin C., Oliver J.D., Alam M., Ali A., Waldor M.K., Qadri F., Martinez-Urtaza J. Vibrio spp. infections. Nat Rev Dis Primers. 2018;4(1): 8. doi: 10.1038/s41572-018-0005-8.
  14. Li L., Meng H., Gu D., Li Y., Jia M. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol Res. 2019. 222: 43-51. doi: 10.1016/j.micres.2019.03.003.
  15. Rezny B.R., Evans D.S. Vibrio parahaemolyticus. In: StatPearls [Internet]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2020 Jan. 2020 Jul 3. https://www.ncbi.nlm.nih.gov/books/NBK459164/
  16. Guan H., Zhang J., Xiao Y., Sha D., Ling X., Kan B. Evaluation of PCR Based Assays for the Improvement of Proportion Estimation of Bacterial and Viral Pathogens in Diarrheal Surveillance. Front Microbiol. 2016. 7: 386. doi: 10.3389/fmicb.2016.00386.
  17. Bonnin-Jusserand M., Copin S., Le Bris C., Brauge T., Gay M., Brisabois A., Grard T., Midelet-Bourdin G. Vibrio species involved in seafood-borne outbreaks (Vibrio cholerae, V. parahaemolyticus and V. vulnificus): Review of microbiological versus recent molecular detection methods in seafood products. Crit Rev Food Sci Nutr. 2019; 59(4): 597-610. doi: 10.1080/10408398.2017.1384715.
  18. Chemisova O.S., Trukhachev A.L., Rykovskaya O.A., Poleeva M.V. [Method for identification of Vibrio parahaemolyticus strains by real-time PCR]. Patent RF [Patent of the Russian Federation] № 2644232, published on 08.02.2018. Byul. № 4. (in Russian).
  19. Poleeva M.V., Chemisova O.S., Trukhachev A.L. [The development of Real-Time PCR method for indication and identification of Vibrio parahaemolyticus]. Vestnik Permskogo universiteta. Biologija [Bulletin of Perm University. Biology]. 2019; 2: 175-181. doi: 10.17072/1994-9952-2019-2-175-181. (in Russian).
  20. Vodopyanov A.S., Vodopyanov S.O., Pisanov R.V., Mishan'kin B.N., Kuleshov К.V., Shipulin G.А., Olejnikov I.P. [Algorithm for analyzing the results of full-genome sequencing on the example of cholera pathogen strains isolated on the territory of the Russian Federation] // Molekulyarnaya diagnostika [Molecular diagnostics]. 2014; 1: 461-462. (in Russian).
  21. Vodopyanov A.S., Vodopyanov S.O., Mishan'kin B.N., Olejnikov I.P. [Computer VNTR-genotyping algorithm based on the partial sequence data of Vibrio cholerae strains from Haitian outbreak (2010)] // Zdorov’e Naseleniya i Sreda Obitaniya [Public Health and Life Environment]. 2013; № 3 (240): 28-30. (in Russian).
  22. Ma C., Wu X., Sun D., Park E., Catipovic M.A., Rapoport T.A., Gao N., Li L. Structure of the substrate-engaged SecA-SecY protein translocation machine. Nat Commun. 2019;10(1): 2872. doi: 10.1038/s41467-019-10918-2.
  23. Smets D., Loos M.S., Karamanou S., Economou A. Protein Transport Across the Bacterial Plasma Membrane by the Sec Pathway. Protein J. 2019; 38(3): 262-273. doi: 10.1007/s10930-019-09841-8.

Supplementary files

There are no supplementary files to display.


Copyright (c) Eco-vector



СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ: 014448 от 08.02.1996
СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ: серия ЭЛ № ФС 77 - 80652 от 15.03.2021
.


This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies